C. testosteroni is a research topic that can degrade steroid hormones into water and carbon dioxide through a series of enzymes in the body. Short-chain dehydrogenase (SDR) are a class of NAD (P) H-dependent oxidoreductases in C. testosteroni. Its main function is catalyzing the redox of the hydroxyl/ketone group of the hormone. In this paper, a SDR gene(SDRx) is cloned from C. testosteroni ATCC11996 and expressed. The polyclonal antibody was prepared and the SDRx gene knocked out by homologous recombination. Wild type and mutant C. testosteroni induced by testosterone, estradiol, estrone and estriol. The growth curves of the bacteria were measured by spectrophotometer. ELISA established the expression of SDRx protein, and high-performance liquid chromatography(HPLC) detected the contents of various hormones. The results show that the growth of wild type was faster than mutant type induced by testosterone. The concentration of SDRx is 0.318 mg/ml under testosterone induction. It has a great change in steroid hormones residue in culture medium measured by HPLC: Testosterone residue in the mutant type group was 42.4 % more than the wild type in culture medium. The same thing happens with induced by estrone. In summary, this SDRx gene involved in the degradation of testosterone and estradiol, and effects the growth of C. testosteroni.

Bovine C Reactive Protein (CRP) ELISA Kit

DL-CRP-b-48 1 kit of 48 tests
EUR 510.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Bovine C Reactive Protein (CRP)

Bovine C Reactive Protein (CRP) ELISA Kit

DL-CRP-b-96 1 kit of 96 tests
EUR 685.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Bovine C Reactive Protein (CRP)

Chicken C Reactive Protein (CRP) ELISA Kit

DL-CRP-Ch-192 1 kit of 192 tests
EUR 1130.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Chicken C Reactive Protein (CRP)

Chicken C Reactive Protein (CRP) ELISA Kit

DL-CRP-Ch-48 1 kit of 48 tests
EUR 474.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Chicken C Reactive Protein (CRP)

Chicken C Reactive Protein (CRP) ELISA Kit

DL-CRP-Ch-96 1 kit of 96 tests
EUR 635.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Chicken C Reactive Protein (CRP)

Human C Reactive Protein (CRP) ELISA Kit

DL-CRP-Hu-192 1 kit of 192 tests
EUR 807.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human C Reactive Protein (CRP)

Human C Reactive Protein (CRP) ELISA Kit

DL-CRP-Hu-48 1 kit of 48 tests
EUR 361.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human C Reactive Protein (CRP)

Human C Reactive Protein (CRP) ELISA Kit

DL-CRP-Hu-96 1 kit of 96 tests
EUR 473.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human C Reactive Protein (CRP)

Mouse C Reactive Protein (CRP) ELISA Kit

DL-CRP-Mu-192 1 kit of 192 tests
EUR 1079.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse C Reactive Protein (CRP)

Mouse C Reactive Protein (CRP) ELISA Kit

DL-CRP-Mu-48 1 kit of 48 tests
EUR 456.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse C Reactive Protein (CRP)

Mouse C Reactive Protein (CRP) ELISA Kit

DL-CRP-Mu-96 1 kit of 96 tests
EUR 609.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse C Reactive Protein (CRP)

Porcine C Reactive Protein (CRP) ELISA Kit

DL-CRP-p-192 1 kit of 192 tests
EUR 1231.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Porcine C Reactive Protein (CRP)

Porcine C Reactive Protein (CRP) ELISA Kit

DL-CRP-p-48 1 kit of 48 tests
EUR 510.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Porcine C Reactive Protein (CRP)

Porcine C Reactive Protein (CRP) ELISA Kit

DL-CRP-p-96 1 kit of 96 tests
EUR 685.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Porcine C Reactive Protein (CRP)

Rat C Reactive Protein (CRP) ELISA Kit

DL-CRP-Ra-192 1 kit of 192 tests
EUR 916.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat C Reactive Protein (CRP)

Rat C Reactive Protein (CRP) ELISA Kit

DL-CRP-Ra-48 1 kit of 48 tests
EUR 399.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat C Reactive Protein (CRP)

Rat C Reactive Protein (CRP) ELISA Kit

DL-CRP-Ra-96 1 kit of 96 tests
EUR 528.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat C Reactive Protein (CRP)

Rabbit C Reactive Protein (CRP) ELISA Kit

DL-CRP-Rb-192 1 kit of 192 tests
EUR 1130.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rabbit C Reactive Protein (CRP)

Rabbit C Reactive Protein (CRP) ELISA Kit

DL-CRP-Rb-48 1 kit of 48 tests
EUR 474.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rabbit C Reactive Protein (CRP)

Rabbit C Reactive Protein (CRP) ELISA Kit

DL-CRP-Rb-96 1 kit of 96 tests
EUR 635.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rabbit C Reactive Protein (CRP)

Bovine C Reactive Protein (CRP) ELISA Kit

DLR-CRP-b-48T 48T
EUR 547.00
  • Should the Bovine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Bovine C Reactive Protein (CRP) ELISA Kit

DLR-CRP-b-96T 96T
EUR 715.00
  • Should the Bovine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Chicken C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Ch-48T 48T
EUR 508.00
  • Should the Chicken C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Chicken C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Ch-96T 96T
EUR 661.00
  • Should the Chicken C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Hu-48T 48T
EUR 385.00
  • Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Hu-96T 96T
EUR 492.00
  • Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids.

Mouse C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Mu-48T 48T
EUR 489.00
  • Should the Mouse C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Mu-96T 96T
EUR 635.00
  • Should the Mouse C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine C Reactive Protein (CRP) ELISA Kit

DLR-CRP-p-48T 48T
EUR 547.00
  • Should the Porcine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine C Reactive Protein (CRP) ELISA Kit

DLR-CRP-p-96T 96T
EUR 715.00
  • Should the Porcine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Ra-48T 48T
EUR 426.00
  • Should the Rat C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Ra-96T 96T
EUR 549.00
  • Should the Rat C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rabbit C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Rb-48T 48T
EUR 508.00
  • Should the Rabbit C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Rabbit C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Rb-96T 96T
EUR 661.00
  • Should the Rabbit C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Bovine C Reactive Protein (CRP) ELISA Kit

RD-CRP-b-48Tests 48 Tests
EUR 555.00

Bovine C Reactive Protein (CRP) ELISA Kit

RD-CRP-b-96Tests 96 Tests
EUR 771.00

Chicken C Reactive Protein (CRP) ELISA Kit

RD-CRP-Ch-48Tests 48 Tests
EUR 511.00

Chicken C Reactive Protein (CRP) ELISA Kit

RD-CRP-Ch-96Tests 96 Tests
EUR 709.00

Human C Reactive Protein (CRP) ELISA Kit

RD-CRP-Hu-48Tests 48 Tests
EUR 372.00

Human C Reactive Protein (CRP) ELISA Kit

RD-CRP-Hu-96Tests 96 Tests
EUR 510.00

Mouse C Reactive Protein (CRP) ELISA Kit

RD-CRP-Mu-48Tests 48 Tests
EUR 489.00

Mouse C Reactive Protein (CRP) ELISA Kit

RD-CRP-Mu-96Tests 96 Tests
EUR 677.00

Porcine C Reactive Protein (CRP) ELISA Kit

RD-CRP-p-48Tests 48 Tests
EUR 555.00

Porcine C Reactive Protein (CRP) ELISA Kit

RD-CRP-p-96Tests 96 Tests
EUR 771.00

Rat C Reactive Protein (CRP) ELISA Kit

RD-CRP-Ra-48Tests 48 Tests
EUR 419.00

Rat C Reactive Protein (CRP) ELISA Kit

RD-CRP-Ra-96Tests 96 Tests
EUR 577.00

Rabbit C Reactive Protein (CRP) ELISA Kit

RD-CRP-Rb-48Tests 48 Tests
EUR 511.00

Rabbit C Reactive Protein (CRP) ELISA Kit

RD-CRP-Rb-96Tests 96 Tests
EUR 709.00

Bovine C Reactive Protein (CRP) ELISA Kit

RDR-CRP-b-48Tests 48 Tests
EUR 580.00

Bovine C Reactive Protein (CRP) ELISA Kit

RDR-CRP-b-96Tests 96 Tests
EUR 807.00

Chicken C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Ch-48Tests 48 Tests
EUR 534.00

Chicken C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Ch-96Tests 96 Tests
EUR 742.00

Human C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Hu-48Tests 48 Tests
EUR 388.00

Human C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Hu-96Tests 96 Tests
EUR 533.00

Mouse C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Mu-48Tests 48 Tests
EUR 511.00

Mouse C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Mu-96Tests 96 Tests
EUR 709.00

Porcine C Reactive Protein (CRP) ELISA Kit

RDR-CRP-p-48Tests 48 Tests
EUR 580.00

Porcine C Reactive Protein (CRP) ELISA Kit

RDR-CRP-p-96Tests 96 Tests
EUR 807.00

Rat C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Ra-48Tests 48 Tests
EUR 437.00

Rat C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Ra-96Tests 96 Tests
EUR 603.00

Rabbit C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Rb-48Tests 48 Tests
EUR 534.00

Rabbit C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Rb-96Tests 96 Tests
EUR 742.00

Guinea pig C Reactive Protein (CRP) ELISA Kit

DL-CRP-Gu-192 1 kit of 192 tests
EUR 1180.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Guinea pig C Reactive Protein (CRP)

Guinea pig C Reactive Protein (CRP) ELISA Kit

DL-CRP-Gu-48 1 kit of 48 tests
EUR 492.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Guinea pig C Reactive Protein (CRP)

Guinea pig C Reactive Protein (CRP) ELISA Kit

DL-CRP-Gu-96 1 kit of 96 tests
EUR 660.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Guinea pig C Reactive Protein (CRP)

Guinea pig C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Gu-48T 48T
EUR 527.00
  • Should the Guinea pig C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Guinea pig C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Gu-96T 96T
EUR 688.00
  • Should the Guinea pig C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Guinea pig C Reactive Protein (CRP) ELISA Kit

RD-CRP-Gu-48Tests 48 Tests
EUR 533.00

Guinea pig C Reactive Protein (CRP) ELISA Kit

RD-CRP-Gu-96Tests 96 Tests
EUR 740.00

Guinea pig C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Gu-48Tests 48 Tests
EUR 557.00

Guinea pig C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Gu-96Tests 96 Tests
EUR 774.00

TruStrip RDT Dog C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack

CRP-RDT-D10 1 pack
EUR 171.00

TruStrip RDT Human C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack

CRP-RDT-H10 1 pack
EUR 171.00

TruStrip RDT Human C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack

CRP-RDT-H25 1 pack
EUR 293.00

TruStrip RDT Monkey C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack

CRP-RDT-M10 1 pack
EUR 171.00

TruStrip RDT Monkey C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack

CRP-RDT-M25 1 pack
EUR 293.00

TruStrip RDT Rat C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack

CRP-RDT-R10 1 pack
EUR 171.00

TruStrip RDT Rat C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack

CRP-RDT-R25 1 pack
EUR 293.00

CRP c-Reactive Protein (19-224 a.a) Human Recombinant Protein

PROTP02741-2 Regular: 20ug
EUR 317.00
Description: CRP Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 207 amino acids (19-224 a.a.) and having a molecular mass of 23.2kDa.;CRP is purified by proprietary chromatographic techniques.


ELA-E0829r 96 Tests
EUR 886.00

Crp/ Rat Crp ELISA Kit

ELI-02799r 96 Tests
EUR 886.00


QY-E70170 96T
EUR 426.00

CRP Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CRP. Recognizes CRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

CRP Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CRP. Recognizes CRP from Human, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CRP antibody

10R-1042 100 ul
EUR 349.00
Description: Mouse monoclonal CRP antibody

CRP antibody

10-7893 1 mg
EUR 392.00
Description: Mouse monoclonal CRP antibody

CRP antibody

10-7894 1 mg
EUR 403.00
Description: Mouse monoclonal CRP antibody

CRP antibody

10-C189A 1 mg
EUR 245.00
Description: Mouse monoclonal CRP antibody

CRP antibody

10-C189B 1 mg
EUR 420.00
Description: Mouse monoclonal CRP antibody

CRP antibody

10-C33A 1 mg
EUR 238.00
Description: Mouse monoclonal CRP antibody

CRP antibody

10-C33AS 1 mg
EUR 235.00
Description: Mouse monoclonal CRP antibody

CRP antibody

10-C33B 1 mg
EUR 662.00
Description: Mouse monoclonal CRP antibody

CRP antibody

10-C33C 1 mg
EUR 245.00
Description: Mouse monoclonal CRP antibody

CRP antibody

10C-CR2015M1 1 mg
EUR 168.00
Description: Mouse monoclonal CRP antibody

CRP antibody

10C-CR2015M5 1 mg
EUR 165.00
Description: Mouse monoclonal CRP antibody

CRP antibody

10C-CR2015M6 1 mg
EUR 165.00
Description: Mouse monoclonal CRP antibody

CRP antibody

10R-10264 50 ug
EUR 241.00
Description: Mouse monoclonal CRP antibody

CRP antibody

10R-3002 100 ug
EUR 265.00
Description: Mouse monoclonal CRP antibody

CRP antibody

70R-4527 50 ug
EUR 467.00
Description: Rabbit polyclonal CRP antibody raised against the N terminal of CRP

CRP Antiboday

70R-51961 100 ug
EUR 197.00
Description: Purified Rabbit CRP antibody

CRP protein

80R-4350 50 ug
EUR 349.00
Description: Purified Recombinant CRP protein (His tagged)

CRP Antibody

ABD6027 100 ug
EUR 438.00

CRP protein

30C-CP1000U 1 mg
EUR 349.00
Description: Purified native Human CRP protein

CRP protein

30R-2081 100 ug
EUR 322.00
Description: Recombinant human CRP protein

CRP protein

30R-2389 250 ug
EUR 152.00
Description: Purified recombinant Human CRP protein

CRP protein

30R-2740 10 ug
EUR 341.00
Description: Purified recombinant Human CRP protein

CRP protein

30R-2984 1 mg
EUR 380.00
Description: Purified recombinant Human CRP protein

CRP Protein

30R-3412 1 mg
EUR 300.00
Description: Human C-reactive protein

CRP protein

30R-AC001x 10 mg
EUR 457.00
Description: Highly purifed Human CRP protein

CRP protein

30R-AC067 1 mg
EUR 448.00
Description: Purified native Human CRP protein

CRP Antibody

31062-100ul 100ul
EUR 252.00

CRP Antibody

31062-50ul 50ul
EUR 187.00

CRP Antibody

32023-100ul 100ul
EUR 252.00

CRP protein

30-1092 1 mg
EUR 393.00
Description: Purified recombinant Human CRP protein

CRP protein

30-1094 100 ug
EUR 155.00
Description: Purified native Human CRP protein

CRP protein

30-1906 1 mg
EUR 336.00
Description: Native human CRP protein

CRP protein

30-AC05 5 mg
EUR 277.00
Description: Highly purified Human CRP protein

CRP protein

30-AC07 5 mg
EUR 1029.00
Description: Purified Recombinant CRP protein

CRP protein

30-AC10 5 mg
EUR 250.00
Description: Partially purified Human CRP protein

CRP antibody

10-1004 1 mg
EUR 457.00
Description: Mouse monoclonal CRP antibody

CRP antibody

10-2276 100 ug
EUR 221.00
Description: Recombinant Fab monoclonal CRP antibody

CRP antibody

10-2349 1 mg
EUR 349.00
Description: Mouse monoclonal CRP antibody

CRP antibody

10-2350 1 mg
EUR 349.00
Description: Mouse monoclonal CRP antibody

CRP antibody

10-2703 1 mg
EUR 165.00
Description: Mouse Monoclonal CRP antibody

CRP antibody

10R-8426 100 ul
EUR 393.00
Description: Mouse monoclonal CRP antibody

CRP antibody

10R-C189a 1 mg
EUR 284.00
Description: Mouse monoclonal CRP antibody

CRP antibody

10R-C189b 1 mg
EUR 399.00
Description: Mouse monoclonal CRP antibody

CRP antibody

20C-CR2015S 1 ml
EUR 133.00
Description: Sheep polyclonal CRP antibody

CRP antibody

20C-CR2015SP 1 ml
EUR 177.00
Description: Sheep polyclonal CRP antibody

CRP antibody

20-1002 1 ml
EUR 111.00
Description: Goat polyclonal Human CRP antibody

CRP antibody

20-1003 1 ml
EUR 133.00
Description: Rabbit polyclonal Human CRP antibody

CRP antibody

20-1262 1 ml
EUR 647.00
Description: Sheep polyclonal CRP antibody

CRP antibody

20-B9007G000-W0 10 ml
EUR 116.00
Description: Goat polyclonal Human CRP antibody

CRP antibody

20-B9007GD00-D0 5 mg
EUR 138.00
Description: Goat polyclonal Human CRP antibody

CRP antibody

20-S3903GND1-D0 1 ml
EUR 133.00
Description: Polyclonal CRP antibody

CRP antibody

20-S3903GND9-D0 10 ml
EUR 127.00
Description: Goat polyclonal Human CRP antibody

CRP antibody

20-S3911G000-S4 10 ml
EUR 116.00
Description: Goat polyclonal Human CRP antibody

CRP antibody

20-S3911G000-V0 10 ml
EUR 133.00
Description: Goat polyclonal Human CRP antibody

CRP antibody

20-S3911G001-V0 10 ml
EUR 133.00
Description: Goat polyclonal Human CRP antibody

CRP antibody

20-S6011G000-S4 10 ml
EUR 138.00
Description: Goat polyclonal CRP antibody

CRP antibody

70-B9007GA00-A0 5 mg
EUR 241.00
Description: Goat polyclonal Human CRP antibody

CRP antibody

70R-10663 1 ml
EUR 484.00
Description: Rabbit polyclonal CRP antibody

CRP antibody

70R-13710 100 ug
EUR 322.00
Description: Affinity purified Sheep polyclonal CRP antibody

CRP Antibody

EUR 338.00

CRP Antibody

EUR 146.00


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CRP Protein

abx069766-50ml 50 ml
EUR 1205.00
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CRP Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CRP. Recognizes CRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CRP Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CRP. Recognizes CRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300

crp Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against crp. Recognizes crp from Escherichia coli. This antibody is Unconjugated. Tested in the following application: ELISA

CRP Antigen

E64C00501 1mg
EUR 700.00

CRP Antigen

E64C00502 1mg
EUR 700.00


YF-PA27200 50 ug
EUR 363.00
Description: Mouse polyclonal to CRP

CRP Antibody

BF0116 200ul
EUR 376.00
Description: CRP antibody detects endogenous levels of total CRP.

CRP Antibody

DF6027 200ul
EUR 304.00
Description: CRP Antibody detects endogenous levels of total CRP.

hs-CRP/ Rat hs- CRP ELISA Kit

ELA-E0821r 96 Tests
EUR 886.00

Crp sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3960403 1.0 ug DNA
EUR 154.00

CRP sgRNA CRISPR Lentivector (Human) (Target 2)

K0509803 1.0 ug DNA
EUR 154.00

Crp sgRNA CRISPR Lentivector (Rat) (Target 2)

K6907603 1.0 ug DNA
EUR 154.00

CRP monoclonal antibody

10R-11480 1 mg
EUR 354.00
Description: Mouse anti-human C-reactive protein monoclonal antibody

CRP, human recombinant

EUR 256.00

CRP, human recombinant

EUR 5270.00

CRP, human recombinant

EUR 588.00

CRP, human recombinant

EUR 332.00

CRP, human recombinant

EUR 147.00

CRP Polyclonal Antibody

41605-100ul 100ul
EUR 252.00

CRP Polyclonal Antibody

41605-50ul 50ul
EUR 187.00

CRP Polyclonal Antibody

A52500 100 µg
EUR 570.55
Description: reagents widely cited

crp Polyclonal Antibody

A55435 100 µg
EUR 570.55
Description: Ask the seller for details

CRP Polyclonal Antibody

ABP52927-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human CRP
  • Applications tips:
Description: A polyclonal antibody for detection of CRP from Human, Rat. This CRP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CRP

CRP Polyclonal Antibody

ABP52927-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human CRP
  • Applications tips:
Description: A polyclonal antibody for detection of CRP from Human, Rat. This CRP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CRP

CRP Polyclonal Antibody

ABP52927-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human CRP
  • Applications tips:
Description: A polyclonal antibody for detection of CRP from Human, Rat. This CRP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CRP

Human CRP Antibody

abx023919-10ml 10 ml
EUR 356.00
  • Shipped within 5-10 working days.

Human CRP Protein

abx060113-1mg 1 mg
EUR 453.00
  • Shipped within 5-10 working days.

Human CRP Protein

abx060138-1mg 1 mg
EUR 453.00
  • Shipped within 5-10 working days.

Human CRP Protein

abx060712-1mg 1 mg
EUR 704.00
  • Shipped within 5-10 working days.

CRP cloning plasmid

CSB-CL005991HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 276
  • Sequence: atggagaagctgttgtgtttcttggtcttgaccagcctctctcatgcttttggccagacagacatgtcgaggaaggcttttgtgtttcccaaagagtcggatacttcctatgtatccctcaaagcaccgttaacgaagcctctcaaagccttcactgtgtgcctccacttctacac
  • Show more
Description: A cloning plasmid for the CRP gene.

CRP cloning plasmid

CSB-CL005991HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 141
  • Sequence: atgtgggactttgtgctgtcaccagatgagattaacaccatctatcttggcgggcccttcagtcctaatgtcctgaactggcgggcactgaagtatgaagtgcaaggcgaagtgttcaccaaaccccagctgtggccctga
Description: A cloning plasmid for the CRP gene.

CRP cloning plasmid

CSB-CL005991HU3-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 675
  • Show more
Description: A cloning plasmid for the CRP gene.

CRP Blocking Peptide

33R-5929 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRP antibody, catalog no. 70R-4527

CRP protein (Canine)

30-1093 100 ug
EUR 702.00
Description: Purified native Canine CRP protein

CRP calibrator set

35-S6021H000-L4 5 ml
EUR 133.00
Description: C-reactive Protein Calibrator Set


55R-IB59126 96 wells
EUR 378.00
Description: ELISA kit for the detection of CRP in the research laboratory


55R-IB79102 96 wells
EUR 579.00
Description: ELISA kit for the detection of CRP in the research laboratory

CRP antibody (FITC)

60R-2348 100 ug
EUR 327.00
Description: Rabbit polyclonal CRP antibody (FITC)

CRP Antibody, HRP

60R-2349 100 ug
EUR 332.00
Description: Rabbit polyclonal CRP antibody (HRP)

CRP Conjugated Antibody

C31062 100ul
EUR 397.00

CRP Conjugated Antibody

C32023 100ul
EUR 397.00

Theme BCF By aThemeArt - Proudly powered by WordPress .