Phytoestrogens protect joints in collagen induced arthritis by increasing IgG glycosylation and reducing osteoclast activation.

Based on previous studies, we know that estrogen can protect the joints from arthritis development by increasing IgG glycosylation and inhibiting osteoclast activation. Phytoestrogens, especially genistein and daidzein, are structurally similar to estradiol that can bind to estrogen receptors (ERs). However, how phytoestrogens affect IgG glycosylation and osteoclast activation in vivo are not investigated so far. In this study, we used 20 mg/kg genistein or daidzein to gavage the female DBA1/J mice in collagen induced arthritis (CIA). We assessed arthritis and bone erosion by clinical scores, histopathology, and micro-CT analysis. Inflammatory cells such as neutrophils, B cells, macrophages and T cells in the peripheral blood were analyzed by flow cytometry. Phagocytic function of peritoneal macrophages was assessed by using FITC-labeled Escherichia coli. New monoclonal antibodies against CII were produced, purified and analyzed. Glycosylation levels of polyclonal and monoclonal IgG were detected by lectin-ELISA. Quantitative PCR was used to analyze the genes related to IgG glycosylation (B4galt1, St6gal1) and osteoclasts (TRAP, NFATC1, c-Fos). Expression of NF-κB and Akt signaling pathways as well as downstream transcription factors NFATc1 and c-Fos was studied by Western blot. Our results show that phytoestrogens protect mice from CIA by increasing IgG glycosylation leading to amelioration of inflammation and inhibiting the NF-κB pathway and NFATc1/c-Fos to decrease the activity of osteoclasts. In conclusion, phytoestrogens can protect bone and joints in CIA mice by increasing IgG glycosylation and inhibiting osteoclast activity.

Bovine C Reactive Protein (CRP) ELISA Kit
DLR-CRP-b-96T	DL Develop	96T	EUR 715
Should the Bovine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Chicken C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Ch-48T	DL Develop	48T	EUR 508
Should the Chicken C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Chicken C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Ch-96T	DL Develop	96T	EUR 661
Should the Chicken C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Hu-48T	DL Develop	48T	EUR 385
Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Hu-96T	DL Develop	96T	EUR 492
Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids.

Mouse C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Mu-48T	DL Develop	48T	EUR 489
Should the Mouse C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Mu-96T	DL Develop	96T	EUR 635
Should the Mouse C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine C Reactive Protein (CRP) ELISA Kit
DLR-CRP-p-48T	DL Develop	48T	EUR 547
Should the Porcine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine C Reactive Protein (CRP) ELISA Kit
DLR-CRP-p-96T	DL Develop	96T	EUR 715
Should the Porcine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Ra-48T	DL Develop	48T	EUR 426
Should the Rat C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Ra-96T	DL Develop	96T	EUR 549
Should the Rat C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rabbit C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Rb-48T	DL Develop	48T	EUR 508
Should the Rabbit C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Rabbit C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Rb-96T	DL Develop	96T	EUR 661
Should the Rabbit C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Bovine C Reactive Protein (CRP) ELISA Kit
RDR-CRP-b-48Tests	Reddot Biotech	48 Tests	EUR 580

Bovine C Reactive Protein (CRP) ELISA Kit
RDR-CRP-b-96Tests	Reddot Biotech	96 Tests	EUR 807

Chicken C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Ch-48Tests	Reddot Biotech	48 Tests	EUR 534

Chicken C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Ch-96Tests	Reddot Biotech	96 Tests	EUR 742

Human C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 388

Human C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 533

Mouse C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Porcine C Reactive Protein (CRP) ELISA Kit
RDR-CRP-p-48Tests	Reddot Biotech	48 Tests	EUR 580

Porcine C Reactive Protein (CRP) ELISA Kit
RDR-CRP-p-96Tests	Reddot Biotech	96 Tests	EUR 807

Rat C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 437

Rat C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 603

Rabbit C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Rb-48Tests	Reddot Biotech	48 Tests	EUR 534

Rabbit C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Rb-96Tests	Reddot Biotech	96 Tests	EUR 742

Bovine C Reactive Protein (CRP) ELISA Kit
RD-CRP-b-48Tests	Reddot Biotech	48 Tests	EUR 555

Bovine C Reactive Protein (CRP) ELISA Kit
RD-CRP-b-96Tests	Reddot Biotech	96 Tests	EUR 771

Chicken C Reactive Protein (CRP) ELISA Kit
RD-CRP-Ch-48Tests	Reddot Biotech	48 Tests	EUR 511

Chicken C Reactive Protein (CRP) ELISA Kit
RD-CRP-Ch-96Tests	Reddot Biotech	96 Tests	EUR 709

Human C Reactive Protein (CRP) ELISA Kit
RD-CRP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 372

Human C Reactive Protein (CRP) ELISA Kit
RD-CRP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 510

Mouse C Reactive Protein (CRP) ELISA Kit
RD-CRP-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse C Reactive Protein (CRP) ELISA Kit
RD-CRP-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Porcine C Reactive Protein (CRP) ELISA Kit
RD-CRP-p-48Tests	Reddot Biotech	48 Tests	EUR 555

Porcine C Reactive Protein (CRP) ELISA Kit
RD-CRP-p-96Tests	Reddot Biotech	96 Tests	EUR 771

Rat C Reactive Protein (CRP) ELISA Kit
RD-CRP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 419

Rat C Reactive Protein (CRP) ELISA Kit
RD-CRP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 577

Rabbit C Reactive Protein (CRP) ELISA Kit
RD-CRP-Rb-48Tests	Reddot Biotech	48 Tests	EUR 511

Rabbit C Reactive Protein (CRP) ELISA Kit
RD-CRP-Rb-96Tests	Reddot Biotech	96 Tests	EUR 709

Guinea pig C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Gu-48T	DL Develop	48T	EUR 527
Should the Guinea pig C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Guinea pig C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Gu-96T	DL Develop	96T	EUR 688
Should the Guinea pig C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Guinea pig C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Gu-48Tests	Reddot Biotech	48 Tests	EUR 557

Guinea pig C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Gu-96Tests	Reddot Biotech	96 Tests	EUR 774

Guinea pig C Reactive Protein (CRP) ELISA Kit
RD-CRP-Gu-48Tests	Reddot Biotech	48 Tests	EUR 533

Guinea pig C Reactive Protein (CRP) ELISA Kit
RD-CRP-Gu-96Tests	Reddot Biotech	96 Tests	EUR 740

TruStrip RDT Dog C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack
CRP-RDT-D10	Alpha Diagnostics	1 pack	EUR 171

TruStrip RDT Human C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack
CRP-RDT-H10	Alpha Diagnostics	1 pack	EUR 171

TruStrip RDT Human C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack
CRP-RDT-H25	Alpha Diagnostics	1 pack	EUR 293

TruStrip RDT Monkey C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack
CRP-RDT-M10	Alpha Diagnostics	1 pack	EUR 171

TruStrip RDT Monkey C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack
CRP-RDT-M25	Alpha Diagnostics	1 pack	EUR 293

TruStrip RDT Rat C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack
CRP-RDT-R10	Alpha Diagnostics	1 pack	EUR 171

TruStrip RDT Rat C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack
CRP-RDT-R25	Alpha Diagnostics	1 pack	EUR 293

CRP/ Rat CRP ELISA Kit
ELA-E0829r	Lifescience Market	96 Tests	EUR 886

Crp/ Rat Crp ELISA Kit
ELI-02799r	Lifescience Market	96 Tests	EUR 886

Canine CRP(CRP) ELISA Kit
QY-E70170	Qayee Biotechnology	96T	EUR 426

CRP protein
30C-CP1000U	Fitzgerald	1 mg	EUR 349
Description: Purified native Human CRP protein

CRP protein
30R-2081	Fitzgerald	100 ug	EUR 322
Description: Recombinant human CRP protein

CRP protein
30R-2389	Fitzgerald	250 ug	EUR 152
Description: Purified recombinant Human CRP protein

CRP protein
30R-2740	Fitzgerald	10 ug	EUR 341
Description: Purified recombinant Human CRP protein

CRP protein
30R-2984	Fitzgerald	1 mg	EUR 380
Description: Purified recombinant Human CRP protein

CRP Protein
30R-3412	Fitzgerald	1 mg	EUR 300
Description: Human C-reactive protein

CRP protein
30R-AC001x	Fitzgerald	10 mg	EUR 457
Description: Highly purifed Human CRP protein

CRP protein
30R-AC067	Fitzgerald	1 mg	EUR 448
Description: Purified native Human CRP protein

CRP protein
30-1092	Fitzgerald	1 mg	EUR 393
Description: Purified recombinant Human CRP protein

CRP protein
30-1094	Fitzgerald	100 ug	EUR 155
Description: Purified native Human CRP protein

CRP protein
30-1906	Fitzgerald	1 mg	EUR 336
Description: Native human CRP protein

CRP protein
30-AC05	Fitzgerald	5 mg	EUR 277
Description: Highly purified Human CRP protein

CRP protein
30-AC07	Fitzgerald	5 mg	EUR 1029
Description: Purified Recombinant CRP protein

CRP protein
30-AC10	Fitzgerald	5 mg	EUR 250
Description: Partially purified Human CRP protein

CRP antibody
20C-CR2015S	Fitzgerald	1 ml	EUR 133
Description: Sheep polyclonal CRP antibody

CRP antibody
20C-CR2015SP	Fitzgerald	1 ml	EUR 177
Description: Sheep polyclonal CRP antibody

CRP Antibody
31062-100ul	SAB	100ul	EUR 252

CRP Antibody
31062-50ul	SAB	50ul	EUR 187

CRP antibody
70R-10663	Fitzgerald	1 ml	EUR 484
Description: Rabbit polyclonal CRP antibody

CRP antibody
70-B9007GA00-A0	Fitzgerald	5 mg	EUR 241
Description: Goat polyclonal Human CRP antibody

CRP Antibody
6690-100	Biovision		EUR 338

CRP Antibody
6690-30T	Biovision		EUR 146

CRP antibody
70R-13710	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Sheep polyclonal CRP antibody

CRP Antibody
32023-100ul	SAB	100ul	EUR 252

CRP antibody
10R-3002	Fitzgerald	100 ug	EUR 265
Description: Mouse monoclonal CRP antibody

CRP antibody
10R-C189a	Fitzgerald	1 mg	EUR 284
Description: Mouse monoclonal CRP antibody

CRP antibody
10R-C189b	Fitzgerald	1 mg	EUR 399
Description: Mouse monoclonal CRP antibody

CRP antibody
10C-CR2015M1	Fitzgerald	1 mg	EUR 168
Description: Mouse monoclonal CRP antibody

CRP antibody
10C-CR2015M5	Fitzgerald	1 mg	EUR 165
Description: Mouse monoclonal CRP antibody

CRP antibody
10C-CR2015M6	Fitzgerald	1 mg	EUR 165
Description: Mouse monoclonal CRP antibody

CRP antibody
10R-10264	Fitzgerald	50 ug	EUR 241
Description: Mouse monoclonal CRP antibody

CRP antibody
10R-1042	Fitzgerald	100 ul	EUR 349
Description: Mouse monoclonal CRP antibody

CRP antibody
10-2276	Fitzgerald	100 ug	EUR 221
Description: Recombinant Fab monoclonal CRP antibody

CRP antibody
10-2349	Fitzgerald	1 mg	EUR 349
Description: Mouse monoclonal CRP antibody

CRP antibody
10-2350	Fitzgerald	1 mg	EUR 349
Description: Mouse monoclonal CRP antibody

CRP antibody
10-2703	Fitzgerald	1 mg	EUR 165
Description: Mouse Monoclonal CRP antibody

CRP antibody
10-7893	Fitzgerald	1 mg	EUR 392
Description: Mouse monoclonal CRP antibody

CRP antibody
10-7894	Fitzgerald	1 mg	EUR 403
Description: Mouse monoclonal CRP antibody

CRP antibody
10-C189A	Fitzgerald	1 mg	EUR 245
Description: Mouse monoclonal CRP antibody

CRP antibody
10-C189B	Fitzgerald	1 mg	EUR 420
Description: Mouse monoclonal CRP antibody

CRP antibody
10-C33A	Fitzgerald	1 mg	EUR 238
Description: Mouse monoclonal CRP antibody

CRP antibody
10-C33AS	Fitzgerald	1 mg	EUR 235
Description: Mouse monoclonal CRP antibody

CRP antibody
10-C33B	Fitzgerald	1 mg	EUR 662
Description: Mouse monoclonal CRP antibody

CRP antibody
10-C33C	Fitzgerald	1 mg	EUR 245
Description: Mouse monoclonal CRP antibody

CRP antibody
20-1002	Fitzgerald	1 ml	EUR 111
Description: Goat polyclonal Human CRP antibody

CRP antibody
20-1003	Fitzgerald	1 ml	EUR 133
Description: Rabbit polyclonal Human CRP antibody

CRP antibody
20-1262	Fitzgerald	1 ml	EUR 647
Description: Sheep polyclonal CRP antibody

CRP antibody
20-B9007G000-W0	Fitzgerald	10 ml	EUR 116
Description: Goat polyclonal Human CRP antibody

CRP antibody
20-B9007GD00-D0	Fitzgerald	5 mg	EUR 138
Description: Goat polyclonal Human CRP antibody

CRP antibody
20-S3903GND1-D0	Fitzgerald	1 ml	EUR 133
Description: Polyclonal CRP antibody

CRP antibody
20-S3903GND9-D0	Fitzgerald	10 ml	EUR 127
Description: Goat polyclonal Human CRP antibody

CRP antibody
20-S3911G000-S4	Fitzgerald	10 ml	EUR 116
Description: Goat polyclonal Human CRP antibody

CRP antibody
20-S3911G000-V0	Fitzgerald	10 ml	EUR 133
Description: Goat polyclonal Human CRP antibody

CRP antibody
20-S3911G001-V0	Fitzgerald	10 ml	EUR 133
Description: Goat polyclonal Human CRP antibody

CRP antibody
20-S6011G000-S4	Fitzgerald	10 ml	EUR 138
Description: Goat polyclonal CRP antibody

CRP antibody
10R-8426	Fitzgerald	100 ul	EUR 393
Description: Mouse monoclonal CRP antibody

CRP antibody
10-1004	Fitzgerald	1 mg	EUR 457
Description: Mouse monoclonal CRP antibody

CRP Antibody
1-CSB-PA005116	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CRP. Recognizes CRP from Human, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CRP Antibody
1-CSB-PA06079A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CRP. Recognizes CRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CRP Antibody
1-CSB-PA790121	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CRP. Recognizes CRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

CRP Antibody
DF6027	Affbiotech	200ul	EUR 304
Description: CRP Antibody detects endogenous levels of total CRP.

crp Antibody
1-CSB-PA359785LA01ENV	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against crp. Recognizes crp from Escherichia coli. This antibody is Unconjugated. Tested in the following application: ELISA

CRP Antibody
1-CSB-PA181901	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CRP. Recognizes CRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300

CRP protein
80R-4350	Fitzgerald	50 ug	EUR 349
Description: Purified Recombinant CRP protein (His tagged)

CRP antibody
70R-4527	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal CRP antibody raised against the N terminal of CRP

CRP Antiboday
70R-51961	Fitzgerald	100 ug	EUR 197
Description: Purified Rabbit CRP antibody

CRP Protein
abx069766-50ml	Abbexa	50 ml	EUR 1205
Shipped within 5-10 working days.

CRP Antigen
E64C00501	EnoGene	1mg	EUR 700

CRP Antigen
E64C00502	EnoGene	1mg	EUR 700

CRP Antibody
BF0116	Affbiotech	200ul	EUR 376
Description: CRP antibody detects endogenous levels of total CRP.

CRP siRNA
20-abx901269	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CRP siRNA
20-abx912842	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CRP siRNA
20-abx912843	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CRP Antibody
ABD6027	Lifescience Market	100 ug	EUR 438

anti-CRP
YF-PA27200	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to CRP

hs-CRP/ Rat hs- CRP ELISA Kit
ELA-E0821r	Lifescience Market	96 Tests	EUR 886

Anti-14-3-3 alpha + beta Rabbit Monoclonal Antibody
M02431-3	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal 14-3-3 alpha + beta Antibody. Validated in Flow Cytometry, IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

IL-3 Interleukin-3 Human Recombinant Protein, His Tag
PROTP08700-3	BosterBio	Regular: 50ug	EUR 317
Description: Interleukin-3 Human Recombinant produced in E.Coli is single, a non-glycosylated, Polypeptide chain containing 154 amino acids fragment (20-152) and having a total molecular mass of 17.3kDa and fused with a 20 aa N-terminal His tag. ;The IL3 His is purified by proprietary chromatographic techniques.

Individual Reaction Mix 3
G065-3	ABM	200 reactions	EUR 167

3-D Life Thioglycerol
T10-3	Cellendes	180 µl	EUR 48

CRP protein (Canine)
30-1093	Fitzgerald	100 ug	EUR 702
Description: Purified native Canine CRP protein

CRP Rabbit pAb
A15659-100ul	Abclonal	100 ul	EUR 308

CRP Rabbit pAb
A15659-200ul	Abclonal	200 ul	EUR 459

CRP Rabbit pAb
A15659-20ul	Abclonal	20 ul	EUR 183

CRP Rabbit pAb
A15659-50ul	Abclonal	50 ul	EUR 223

CRP calibrator set
35-S6021H000-L4	Fitzgerald	5 ml	EUR 133
Description: C-reactive Protein Calibrator Set

CRP Blocking Peptide
33R-5929	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRP antibody, catalog no. 70R-4527

Anti-CRP Purified
11-480-C100	ExBio	0.1 mg	EUR 204

Anti-CRP Purified
11-484-C100	ExBio	0.1 mg	EUR 204

Anti-CRP Purified
11-537-C100	ExBio	0.1 mg	EUR 204

Human CRP ELISA
1030	Ethos Biosciences	1 kit	EUR 629

Mouse CRP ELISA
1031	Ethos Biosciences	1 kit	EUR 629

Rat CRP ELISA
1032	Ethos Biosciences	1 kit	EUR 629

CRP monoclonal antibody
10R-11480	Fitzgerald	1 mg	EUR 354
Description: Mouse anti-human C-reactive protein monoclonal antibody

Anti-CRP Biotin
1B-484-C100	ExBio	0.1 mg	EUR 286

CRP antibody (FITC)
60R-2348	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal CRP antibody (FITC)

CRP Antibody, HRP
60R-2349	Fitzgerald	100 ug	EUR 332
Description: Rabbit polyclonal CRP antibody (HRP)

CRP, human recombinant
4863-10	Biovision		EUR 256

CRP, human recombinant
4863-1000	Biovision		EUR 5270

CRP, human recombinant
4863-50	Biovision		EUR 588

CRP, human recombinant
4864-1000	Biovision		EUR 332

CRP, human recombinant
4864-250	Biovision		EUR 147

CRP Polyclonal Antibody
41605-100ul	SAB	100ul	EUR 252

CRP Polyclonal Antibody
41605-50ul	SAB	50ul	EUR 187

CRP ELISA kit
55R-IB59126	Fitzgerald	96 wells	EUR 378
Description: ELISA kit for the detection of CRP in the research laboratory

CRP ELISA kit
55R-IB79102	Fitzgerald	96 wells	EUR 579
Description: ELISA kit for the detection of CRP in the research laboratory

Polyclonal CRP Antibody
APG02787G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CRP . This antibody is tested and proven to work in the following applications:

CRP Blocking Peptide
DF6027-BP	Affbiotech	1mg	EUR 195

CRP Rabbit pAb
A0224-100ul	Abclonal	100 ul	EUR 308

CRP Rabbit pAb
A0224-200ul	Abclonal	200 ul	EUR 459

CRP Rabbit pAb
A0224-20ul	Abclonal	20 ul	EUR 183

CRP Rabbit pAb
A0224-50ul	Abclonal	50 ul	EUR 223

Human CRP Antibody
abx023919-10ml	Abbexa	10 ml	EUR 356
Shipped within 5-10 working days.

Human CRP Protein
abx060113-1mg	Abbexa	1 mg	EUR 453
Shipped within 5-10 working days.

Human CRP Protein
abx060138-1mg	Abbexa	1 mg	EUR 453
Shipped within 5-10 working days.

Human CRP Protein
abx060712-1mg	Abbexa	1 mg	EUR 704
Shipped within 5-10 working days.

CRP Conjugated Antibody
C32023	SAB	100ul	EUR 397

CRP Conjugated Antibody
C31062	SAB	100ul	EUR 397

CRP Blocking Peptide
BF0116-BP	Affbiotech	1mg	EUR 195

Large-CRP OmcBProtein
20-abx600013	Abbexa	EUR 843.00 EUR 439.00 EUR 1274.00 EUR 1636.00 EUR 551.00	100 ug 10 ug 200 ug 500 ug 50 ug
Shipped within 1 month.

Large-CRP OmcBProtein
20-abx600014	Abbexa	EUR 2764.00 EUR 1734.00	100 ug 50 ug
Shipped within 3 months.

CRP cloning plasmid
CSB-CL005991HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 276 Sequence: atggagaagctgttgtgtttcttggtcttgaccagcctctctcatgcttttggccagacagacatgtcgaggaaggcttttgtgtttcccaaagagtcggatacttcctatgtatccctcaaagcaccgttaacgaagcctctcaaagccttcactgtgtgcctccacttctacac Show more
Description: A cloning plasmid for the CRP gene.

CRP cloning plasmid
CSB-CL005991HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 141 Sequence: atgtgggactttgtgctgtcaccagatgagattaacaccatctatcttggcgggcccttcagtcctaatgtcctgaactggcgggcactgaagtatgaagtgcaaggcgaagtgttcaccaaaccccagctgtggccctga
Description: A cloning plasmid for the CRP gene.

CRP cloning plasmid
CSB-CL005991HU3-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 675 Sequence: ATGGAGAAGCTGTTGTGTTTCTTGGTCTTGACCAGCCTCTCTCATGCTTTTGGCCAGACAGACATGTCGAGGAAGGCTTTTGTGTTTCCCAAAGAGTCGGATACTTCCTATGTATCCCTCAAAGCACCGTTAACGAAGCCTCTCAAAGCCTTCACTGTGTGCCTCCACTTCTACAC Show more
Description: A cloning plasmid for the CRP gene.

CRP Polyclonal Antibody
ABP52927-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human CRP Applications tips:
Description: A polyclonal antibody for detection of CRP from Human, Rat. This CRP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CRP

CRP Polyclonal Antibody
ABP52927-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human CRP Applications tips:
Description: A polyclonal antibody for detection of CRP from Human, Rat. This CRP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CRP

CRP Polyclonal Antibody
ABP52927-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human CRP Applications tips:
Description: A polyclonal antibody for detection of CRP from Human, Rat. This CRP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CRP

CRP Polyclonal Antibody
A52500	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

crp Polyclonal Antibody
A55435	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

CRP Polyclonal Antibody
ES3926-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CRP from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CRP Polyclonal Antibody
ES3926-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CRP from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

anti- CRP antibody
FNab01994	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IF: 1:50 - 1:200 Immunogen: C-reactive protein, pentraxin-related Uniprot ID: P02741 Gene ID: 1401 Research Area: Immunology, Cardiovascular
Description: Antibody raised against CRP

anti- CRP antibody
FNab01995	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:1000-1:4000 IHC: 1:50-1:500 Immunogen: C-reactive protein, pentraxin-related Uniprot ID: P02741 Gene ID: 1401 Research Area: Immunology, Cardiovascular
Description: Antibody raised against CRP