Based on previous studies, we know that estrogen can protect the joints from arthritis development by increasing IgG glycosylation and inhibiting osteoclast activation. Phytoestrogens, especially genistein and daidzein, are structurally similar to estradiol that can bind to estrogen receptors (ERs). However, how phytoestrogens affect IgG glycosylation and osteoclast activation in vivo are not investigated so far. In this study, we used 20 mg/kg genistein or daidzein to gavage the female DBA1/J mice in collagen induced arthritis (CIA). We assessed arthritis and bone erosion by clinical scores, histopathology, and micro-CT analysis. Inflammatory cells such as neutrophils, B cells, macrophages and T cells in the peripheral blood were analyzed by flow cytometry. Phagocytic function of peritoneal macrophages was assessed by using FITC-labeled Escherichia coli. New monoclonal antibodies against CII were produced, purified and analyzed. Glycosylation levels of polyclonal and monoclonal IgG were detected by lectin-ELISA. Quantitative PCR was used to analyze the genes related to IgG glycosylation (B4galt1, St6gal1) and osteoclasts (TRAP, NFATC1, c-Fos). Expression of NF-κB and Akt signaling pathways as well as downstream transcription factors NFATc1 and c-Fos was studied by Western blot. Our results show that phytoestrogens protect mice from CIA by increasing IgG glycosylation leading to amelioration of inflammation and inhibiting the NF-κB pathway and NFATc1/c-Fos to decrease the activity of osteoclasts. In conclusion, phytoestrogens can protect bone and joints in CIA mice by increasing IgG glycosylation and inhibiting osteoclast activity.
Bovine C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-b-96T |
DL Develop |
96T |
EUR 715 |
- Should the Bovine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Bovine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Chicken C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Ch-48T |
DL Develop |
48T |
EUR 508 |
- Should the Chicken C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Chicken C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids. |
Chicken C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Ch-96T |
DL Develop |
96T |
EUR 661 |
- Should the Chicken C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Chicken C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids. |
Human C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Hu-48T |
DL Develop |
48T |
EUR 385 |
- Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids. |
Human C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Hu-96T |
DL Develop |
96T |
EUR 492 |
- Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids. |
Mouse C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Porcine C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-p-48T |
DL Develop |
48T |
EUR 547 |
- Should the Porcine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Porcine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Porcine C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-p-96T |
DL Develop |
96T |
EUR 715 |
- Should the Porcine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Porcine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Ra-48T |
DL Develop |
48T |
EUR 426 |
- Should the Rat C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Ra-96T |
DL Develop |
96T |
EUR 549 |
- Should the Rat C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rabbit C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Rb-48T |
DL Develop |
48T |
EUR 508 |
- Should the Rabbit C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids. |
Rabbit C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Rb-96T |
DL Develop |
96T |
EUR 661 |
- Should the Rabbit C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids. |
Bovine C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-b-48Tests |
Reddot Biotech |
48 Tests |
EUR 580 |
Bovine C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-b-96Tests |
Reddot Biotech |
96 Tests |
EUR 807 |
Chicken C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Ch-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Chicken C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Ch-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Human C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 388 |
Human C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 533 |
Mouse C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Porcine C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-p-48Tests |
Reddot Biotech |
48 Tests |
EUR 580 |
Porcine C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-p-96Tests |
Reddot Biotech |
96 Tests |
EUR 807 |
Rat C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 437 |
Rat C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 603 |
Rabbit C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Rb-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rabbit C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Rb-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Bovine C Reactive Protein (CRP) ELISA Kit |
RD-CRP-b-48Tests |
Reddot Biotech |
48 Tests |
EUR 555 |
Bovine C Reactive Protein (CRP) ELISA Kit |
RD-CRP-b-96Tests |
Reddot Biotech |
96 Tests |
EUR 771 |
Chicken C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Ch-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Chicken C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Ch-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Human C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 372 |
Human C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 510 |
Mouse C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Porcine C Reactive Protein (CRP) ELISA Kit |
RD-CRP-p-48Tests |
Reddot Biotech |
48 Tests |
EUR 555 |
Porcine C Reactive Protein (CRP) ELISA Kit |
RD-CRP-p-96Tests |
Reddot Biotech |
96 Tests |
EUR 771 |
Rat C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 419 |
Rat C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 577 |
Rabbit C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Rb-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Rabbit C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Rb-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Guinea pig C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Gu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Guinea pig C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids. |
Guinea pig C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Gu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Guinea pig C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids. |
Guinea pig C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Gu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Guinea pig C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Gu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Guinea pig C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Gu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Guinea pig C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Gu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
TruStrip RDT Dog C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack |
CRP-RDT-D10 |
Alpha Diagnostics |
1 pack |
EUR 171 |
TruStrip RDT Human C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack |
CRP-RDT-H10 |
Alpha Diagnostics |
1 pack |
EUR 171 |
TruStrip RDT Human C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack |
CRP-RDT-H25 |
Alpha Diagnostics |
1 pack |
EUR 293 |
TruStrip RDT Monkey C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack |
CRP-RDT-M10 |
Alpha Diagnostics |
1 pack |
EUR 171 |
TruStrip RDT Monkey C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack |
CRP-RDT-M25 |
Alpha Diagnostics |
1 pack |
EUR 293 |
TruStrip RDT Rat C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack |
CRP-RDT-R10 |
Alpha Diagnostics |
1 pack |
EUR 171 |
TruStrip RDT Rat C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack |
CRP-RDT-R25 |
Alpha Diagnostics |
1 pack |
EUR 293 |
CRP protein |
30C-CP1000U |
Fitzgerald |
1 mg |
EUR 349 |
Description: Purified native Human CRP protein |
CRP protein |
30R-2081 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Recombinant human CRP protein |
CRP protein |
30R-2389 |
Fitzgerald |
250 ug |
EUR 152 |
Description: Purified recombinant Human CRP protein |
CRP protein |
30R-2740 |
Fitzgerald |
10 ug |
EUR 341 |
Description: Purified recombinant Human CRP protein |
CRP protein |
30R-2984 |
Fitzgerald |
1 mg |
EUR 380 |
Description: Purified recombinant Human CRP protein |
CRP Protein |
30R-3412 |
Fitzgerald |
1 mg |
EUR 300 |
Description: Human C-reactive protein |
CRP protein |
30R-AC001x |
Fitzgerald |
10 mg |
EUR 457 |
Description: Highly purifed Human CRP protein |
CRP protein |
30R-AC067 |
Fitzgerald |
1 mg |
EUR 448 |
Description: Purified native Human CRP protein |
CRP protein |
30-1092 |
Fitzgerald |
1 mg |
EUR 393 |
Description: Purified recombinant Human CRP protein |
CRP protein |
30-1094 |
Fitzgerald |
100 ug |
EUR 155 |
Description: Purified native Human CRP protein |
CRP protein |
30-1906 |
Fitzgerald |
1 mg |
EUR 336 |
Description: Native human CRP protein |
CRP protein |
30-AC05 |
Fitzgerald |
5 mg |
EUR 277 |
Description: Highly purified Human CRP protein |
CRP protein |
30-AC07 |
Fitzgerald |
5 mg |
EUR 1029 |
Description: Purified Recombinant CRP protein |
CRP protein |
30-AC10 |
Fitzgerald |
5 mg |
EUR 250 |
Description: Partially purified Human CRP protein |
CRP antibody |
20C-CR2015S |
Fitzgerald |
1 ml |
EUR 133 |
Description: Sheep polyclonal CRP antibody |
CRP antibody |
20C-CR2015SP |
Fitzgerald |
1 ml |
EUR 177 |
Description: Sheep polyclonal CRP antibody |
CRP Antibody |
31062-100ul |
SAB |
100ul |
EUR 252 |
CRP Antibody |
31062-50ul |
SAB |
50ul |
EUR 187 |
CRP antibody |
70R-10663 |
Fitzgerald |
1 ml |
EUR 484 |
Description: Rabbit polyclonal CRP antibody |
CRP antibody |
70-B9007GA00-A0 |
Fitzgerald |
5 mg |
EUR 241 |
Description: Goat polyclonal Human CRP antibody |
CRP antibody |
70R-13710 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Affinity purified Sheep polyclonal CRP antibody |
CRP Antibody |
32023-100ul |
SAB |
100ul |
EUR 252 |
CRP antibody |
10R-3002 |
Fitzgerald |
100 ug |
EUR 265 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10R-C189a |
Fitzgerald |
1 mg |
EUR 284 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10R-C189b |
Fitzgerald |
1 mg |
EUR 399 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10C-CR2015M1 |
Fitzgerald |
1 mg |
EUR 168 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10C-CR2015M5 |
Fitzgerald |
1 mg |
EUR 165 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10C-CR2015M6 |
Fitzgerald |
1 mg |
EUR 165 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10R-10264 |
Fitzgerald |
50 ug |
EUR 241 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10R-1042 |
Fitzgerald |
100 ul |
EUR 349 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10-2276 |
Fitzgerald |
100 ug |
EUR 221 |
Description: Recombinant Fab monoclonal CRP antibody |
CRP antibody |
10-2349 |
Fitzgerald |
1 mg |
EUR 349 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10-2350 |
Fitzgerald |
1 mg |
EUR 349 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10-2703 |
Fitzgerald |
1 mg |
EUR 165 |
Description: Mouse Monoclonal CRP antibody |
CRP antibody |
10-7893 |
Fitzgerald |
1 mg |
EUR 392 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10-7894 |
Fitzgerald |
1 mg |
EUR 403 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10-C189A |
Fitzgerald |
1 mg |
EUR 245 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10-C189B |
Fitzgerald |
1 mg |
EUR 420 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10-C33A |
Fitzgerald |
1 mg |
EUR 238 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10-C33AS |
Fitzgerald |
1 mg |
EUR 235 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10-C33B |
Fitzgerald |
1 mg |
EUR 662 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10-C33C |
Fitzgerald |
1 mg |
EUR 245 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
20-1002 |
Fitzgerald |
1 ml |
EUR 111 |
Description: Goat polyclonal Human CRP antibody |
CRP antibody |
20-1003 |
Fitzgerald |
1 ml |
EUR 133 |
Description: Rabbit polyclonal Human CRP antibody |
CRP antibody |
20-1262 |
Fitzgerald |
1 ml |
EUR 647 |
Description: Sheep polyclonal CRP antibody |
CRP antibody |
20-B9007G000-W0 |
Fitzgerald |
10 ml |
EUR 116 |
Description: Goat polyclonal Human CRP antibody |
CRP antibody |
20-B9007GD00-D0 |
Fitzgerald |
5 mg |
EUR 138 |
Description: Goat polyclonal Human CRP antibody |
CRP antibody |
20-S3903GND1-D0 |
Fitzgerald |
1 ml |
EUR 133 |
Description: Polyclonal CRP antibody |
CRP antibody |
20-S3903GND9-D0 |
Fitzgerald |
10 ml |
EUR 127 |
Description: Goat polyclonal Human CRP antibody |
CRP antibody |
20-S3911G000-S4 |
Fitzgerald |
10 ml |
EUR 116 |
Description: Goat polyclonal Human CRP antibody |
CRP antibody |
20-S3911G000-V0 |
Fitzgerald |
10 ml |
EUR 133 |
Description: Goat polyclonal Human CRP antibody |
CRP antibody |
20-S3911G001-V0 |
Fitzgerald |
10 ml |
EUR 133 |
Description: Goat polyclonal Human CRP antibody |
CRP antibody |
20-S6011G000-S4 |
Fitzgerald |
10 ml |
EUR 138 |
Description: Goat polyclonal CRP antibody |
CRP antibody |
10R-8426 |
Fitzgerald |
100 ul |
EUR 393 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10-1004 |
Fitzgerald |
1 mg |
EUR 457 |
Description: Mouse monoclonal CRP antibody |
CRP Antibody |
1-CSB-PA005116 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against CRP. Recognizes CRP from Human, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
CRP Antibody |
1-CSB-PA06079A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CRP. Recognizes CRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
CRP Antibody |
1-CSB-PA790121 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CRP. Recognizes CRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
CRP Antibody |
DF6027 |
Affbiotech |
200ul |
EUR 304 |
Description: CRP Antibody detects endogenous levels of total CRP. |
crp Antibody |
1-CSB-PA359785LA01ENV |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against crp. Recognizes crp from Escherichia coli. This antibody is Unconjugated. Tested in the following application: ELISA |
CRP Antibody |
1-CSB-PA181901 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CRP. Recognizes CRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300 |
CRP protein |
80R-4350 |
Fitzgerald |
50 ug |
EUR 349 |
Description: Purified Recombinant CRP protein (His tagged) |
CRP antibody |
70R-4527 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal CRP antibody raised against the N terminal of CRP |
CRP Antiboday |
70R-51961 |
Fitzgerald |
100 ug |
EUR 197 |
Description: Purified Rabbit CRP antibody |
CRP Protein |
abx069766-50ml |
Abbexa |
50 ml |
EUR 1205 |
- Shipped within 5-10 working days.
|
CRP Antigen |
E64C00501 |
EnoGene |
1mg |
EUR 700 |
CRP Antigen |
E64C00502 |
EnoGene |
1mg |
EUR 700 |
CRP Antibody |
BF0116 |
Affbiotech |
200ul |
EUR 376 |
Description: CRP antibody detects endogenous levels of total CRP. |
CRP siRNA |
20-abx901269 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CRP siRNA |
20-abx912842 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CRP siRNA |
20-abx912843 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-CRP |
YF-PA27200 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to CRP |
Anti-14-3-3 alpha + beta Rabbit Monoclonal Antibody |
M02431-3 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal 14-3-3 alpha + beta Antibody. Validated in Flow Cytometry, IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat. |
IL-3 Interleukin-3 Human Recombinant Protein, His Tag |
PROTP08700-3 |
BosterBio |
Regular: 50ug |
EUR 317 |
Description: Interleukin-3 Human Recombinant produced in E.Coli is single, a non-glycosylated, Polypeptide chain containing 154 amino acids fragment (20-152) and having a total molecular mass of 17.3kDa and fused with a 20 aa N-terminal His tag. ;The IL3 His is purified by proprietary chromatographic techniques. |
Individual Reaction Mix 3 |
G065-3 |
ABM |
200 reactions |
EUR 167 |
3-D Life Thioglycerol |
T10-3 |
Cellendes |
180 µl |
EUR 48 |
CRP protein (Canine) |
30-1093 |
Fitzgerald |
100 ug |
EUR 702 |
Description: Purified native Canine CRP protein |
CRP Rabbit pAb |
A15659-100ul |
Abclonal |
100 ul |
EUR 308 |
CRP Rabbit pAb |
A15659-200ul |
Abclonal |
200 ul |
EUR 459 |
CRP Rabbit pAb |
A15659-20ul |
Abclonal |
20 ul |
EUR 183 |
CRP Rabbit pAb |
A15659-50ul |
Abclonal |
50 ul |
EUR 223 |
CRP calibrator set |
35-S6021H000-L4 |
Fitzgerald |
5 ml |
EUR 133 |
Description: C-reactive Protein Calibrator Set |
CRP Blocking Peptide |
33R-5929 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRP antibody, catalog no. 70R-4527 |
Anti-CRP Purified |
11-480-C100 |
ExBio |
0.1 mg |
EUR 204 |
Anti-CRP Purified |
11-484-C100 |
ExBio |
0.1 mg |
EUR 204 |
Anti-CRP Purified |
11-537-C100 |
ExBio |
0.1 mg |
EUR 204 |
CRP monoclonal antibody |
10R-11480 |
Fitzgerald |
1 mg |
EUR 354 |
Description: Mouse anti-human C-reactive protein monoclonal antibody |
Anti-CRP Biotin |
1B-484-C100 |
ExBio |
0.1 mg |
EUR 286 |
CRP antibody (FITC) |
60R-2348 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal CRP antibody (FITC) |
CRP Antibody, HRP |
60R-2349 |
Fitzgerald |
100 ug |
EUR 332 |
Description: Rabbit polyclonal CRP antibody (HRP) |
CRP, human recombinant |
4863-10 |
Biovision |
|
EUR 256 |
CRP, human recombinant |
4863-1000 |
Biovision |
|
EUR 5270 |
CRP, human recombinant |
4863-50 |
Biovision |
|
EUR 588 |
CRP, human recombinant |
4864-1000 |
Biovision |
|
EUR 332 |
CRP, human recombinant |
4864-250 |
Biovision |
|
EUR 147 |
CRP Polyclonal Antibody |
41605-100ul |
SAB |
100ul |
EUR 252 |
CRP Polyclonal Antibody |
41605-50ul |
SAB |
50ul |
EUR 187 |
CRP ELISA kit |
55R-IB59126 |
Fitzgerald |
96 wells |
EUR 378 |
Description: ELISA kit for the detection of CRP in the research laboratory |
CRP ELISA kit |
55R-IB79102 |
Fitzgerald |
96 wells |
EUR 579 |
Description: ELISA kit for the detection of CRP in the research laboratory |
Polyclonal CRP Antibody |
APG02787G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CRP . This antibody is tested and proven to work in the following applications: |
CRP Blocking Peptide |
DF6027-BP |
Affbiotech |
1mg |
EUR 195 |
CRP Rabbit pAb |
A0224-100ul |
Abclonal |
100 ul |
EUR 308 |
CRP Rabbit pAb |
A0224-200ul |
Abclonal |
200 ul |
EUR 459 |
CRP Rabbit pAb |
A0224-20ul |
Abclonal |
20 ul |
EUR 183 |
CRP Rabbit pAb |
A0224-50ul |
Abclonal |
50 ul |
EUR 223 |
Human CRP Antibody |
abx023919-10ml |
Abbexa |
10 ml |
EUR 356 |
- Shipped within 5-10 working days.
|
Human CRP Protein |
abx060113-1mg |
Abbexa |
1 mg |
EUR 453 |
- Shipped within 5-10 working days.
|
Human CRP Protein |
abx060138-1mg |
Abbexa |
1 mg |
EUR 453 |
- Shipped within 5-10 working days.
|
Human CRP Protein |
abx060712-1mg |
Abbexa |
1 mg |
EUR 704 |
- Shipped within 5-10 working days.
|
CRP Conjugated Antibody |
C32023 |
SAB |
100ul |
EUR 397 |
CRP Conjugated Antibody |
C31062 |
SAB |
100ul |
EUR 397 |
CRP Blocking Peptide |
BF0116-BP |
Affbiotech |
1mg |
EUR 195 |
Large-CRP OmcBProtein |
20-abx600013 |
Abbexa |
-
EUR 843.00
-
EUR 439.00
-
EUR 1274.00
-
EUR 1636.00
-
EUR 551.00
|
-
100 ug
-
10 ug
-
200 ug
-
500 ug
-
50 ug
|
|
Large-CRP OmcBProtein |
20-abx600014 |
Abbexa |
|
|
|
CRP cloning plasmid |
CSB-CL005991HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 276
- Sequence: atggagaagctgttgtgtttcttggtcttgaccagcctctctcatgcttttggccagacagacatgtcgaggaaggcttttgtgtttcccaaagagtcggatacttcctatgtatccctcaaagcaccgttaacgaagcctctcaaagccttcactgtgtgcctccacttctacac
- Show more
|
Description: A cloning plasmid for the CRP gene. |
CRP cloning plasmid |
CSB-CL005991HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 141
- Sequence: atgtgggactttgtgctgtcaccagatgagattaacaccatctatcttggcgggcccttcagtcctaatgtcctgaactggcgggcactgaagtatgaagtgcaaggcgaagtgttcaccaaaccccagctgtggccctga
|
Description: A cloning plasmid for the CRP gene. |
CRP cloning plasmid |
CSB-CL005991HU3-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 675
- Sequence: ATGGAGAAGCTGTTGTGTTTCTTGGTCTTGACCAGCCTCTCTCATGCTTTTGGCCAGACAGACATGTCGAGGAAGGCTTTTGTGTTTCCCAAAGAGTCGGATACTTCCTATGTATCCCTCAAAGCACCGTTAACGAAGCCTCTCAAAGCCTTCACTGTGTGCCTCCACTTCTACAC
- Show more
|
Description: A cloning plasmid for the CRP gene. |
CRP Polyclonal Antibody |
ABP52927-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human CRP
- Applications tips:
|
Description: A polyclonal antibody for detection of CRP from Human, Rat. This CRP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CRP |
CRP Polyclonal Antibody |
ABP52927-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human CRP
- Applications tips:
|
Description: A polyclonal antibody for detection of CRP from Human, Rat. This CRP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CRP |
CRP Polyclonal Antibody |
ABP52927-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human CRP
- Applications tips:
|
Description: A polyclonal antibody for detection of CRP from Human, Rat. This CRP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CRP |
CRP Polyclonal Antibody |
A52500 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
crp Polyclonal Antibody |
A55435 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
CRP Polyclonal Antibody |
ES3926-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CRP from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
CRP Polyclonal Antibody |
ES3926-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CRP from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
anti- CRP antibody |
FNab01994 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IF: 1:50 - 1:200
- Immunogen: C-reactive protein, pentraxin-related
- Uniprot ID: P02741
- Gene ID: 1401
- Research Area: Immunology, Cardiovascular
|
Description: Antibody raised against CRP |
anti- CRP antibody |
FNab01995 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:1000-1:4000
- IHC: 1:50-1:500
- Immunogen: C-reactive protein, pentraxin-related
- Uniprot ID: P02741
- Gene ID: 1401
- Research Area: Immunology, Cardiovascular
|
Description: Antibody raised against CRP |